The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0781
Genome IDAY596297
Search identical group
Phylum/ClassEuryarchaeota
SpeciesHaloarcula marismortui ATCC 43049 [AY596297, AY596298]
Start position on genome 1624366
End posion on genome 1624294
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
gagtgagtgc
tRNA gene sequence
AGTCCCGTGGTGTAGTGGCCAATCATAAGGGCCTTTGGAGCCCTTGACGGCGGTTCGAAT
CCGCCCGGGACTAttt
Downstream region at tRNA end position
tcgcgccaac
Secondary structure (Cloverleaf model)
>At0781	Gln	TTG
                   c      Attt tcgcgccaac
                     A - T
                     G - C
                     T - A
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     C C G C C     A
      T G A        G      | | | | |     G
    G       T G T G       G G C G G     C
    G         | | +                 T T
    C       T C A T
      C A A        A     TGAC
                    A - T
                    G - C
                    G - C
                    G - C
                    C - G
                  C       A
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGTCCCGTGGTGTAGTGGCCAATCATAAGGGCCTTTGGAGCCCTTGACGGCGGTTCGAAT
CCGCCCGGGACTA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK