The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0786
Genome IDAY596297
Search identical group
Phylum/ClassEuryarchaeota
SpeciesHaloarcula marismortui ATCC 43049 [AY596297, AY596298]
Start position on genome 2146679
End posion on genome 2146608
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
cagaccacgc
tRNA gene sequence
GGGCTCGTAGATCAGTGGCAGATCGCTTCCTTCGCAAGGAAGAGGCCCCGGGTTCAAATC
CCGGCGAGTCCAtag
Downstream region at tRNA end position
cgttacttcg
Secondary structure (Cloverleaf model)
>At0786	Ala	CGC
                   c      Atag cgttacttcg
                     G - C
                     G - C
                     G + T
                     C - G
                     T - A
                     C - G
                     G - C          T A
                    T     G G C C C     A
        G A        A      | | | | |     A
      T     C T A G       C C G G G     C
      G     | | | |                 T T
      G     G A T C
        C A        G     AGGCC
                    C - G
                    T - A
                    T - A
                    C - G
                    C - G
                  T       A
                  T       A
                    C G C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCTCGTAGATCAGTGGCAGATCGCTTCCTTCGCAAGGAAGAGGCCCCGGGTTCAAATC
CCGGCGAGTCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK