The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0792
Genome IDAY596298
Search identical group
Phylum/ClassEuryarchaeota
SpeciesHaloarcula marismortui ATCC 43049 [AY596297, AY596298]
Start position on genome 95036
End posion on genome 95109
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
actatattcc
tRNA gene sequence
GGGCTCGGGGCCTATGAGGCACAGGCGTGGGACTTTTAATCCCGAGACAGAGGGTTCGAA
TCCCTCCGAGCCCGctc
Downstream region at tRNA end position
gcatccgttc
Secondary structure (Cloverleaf model)
>At0792	Lys	TTT
                   c      Gctc gcatccgttc
                     G - C
                     G - C
                     G - C
                     C - G
                     T - A
                     C - G
                     G - C          T A
                    G     C T C C C     A
      G T A        G      | | | | |     G
    A       T C C G       G A G G G     C
    G       | | | |                 T T
    G       A G G C
      C A C        G     AGACA
                    T + G
                    G - C
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCTCGGGGCCTATGAGGCACAGGCGTGGGACTTTTAATCCCGAGACAGAGGGTTCGAA
TCCCTCCGAGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK