The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0797
Genome IDAE004437
Search identical group
Phylum/ClassEuryarchaeota
SpeciesHalobacterium salinarum NRC-1; ATCC 700922 [AE004437]
Start position on genome 409659
End posion on genome 409731
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
ccgcgagtgc
tRNA gene sequence
AGTCCCGTGGTGTAGTGGCCAATCATATGGGCCTTTGGAGCCCACGACGGCGGTTCGAAT
CCGCCCGGGACTActc
Downstream region at tRNA end position
accgatccgc
Secondary structure (Cloverleaf model)
>At0797	Gln	TTG
                   c      Actc accgatccgc
                     A - T
                     G - C
                     T - A
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     C C G C C     A
      T G A        G      | | | | |     G
    G       T G T G       G G C G G     C
    G         | | +                 T T
    C       T C A T
      C A A        A     CGAC
                    T - A
                    G - C
                    G - C
                    G - C
                    C - G
                  C       A
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGTCCCGTGGTGTAGTGGCCAATCATATGGGCCTTTGGAGCCCACGACGGCGGTTCGAAT
CCGCCCGGGACTA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK