The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0817
Genome IDAE004437
Search identical group
Phylum/ClassEuryarchaeota
SpeciesHalobacterium salinarum NRC-1; ATCC 700922 [AE004437]
Start position on genome 2002466
End posion on genome 2002538
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
agtgcagcca
tRNA gene sequence
GCCCGGATGGTGTAGTGGCCCATCATACAACCCTGTCACGGTTGTGACGCGGGTTCAAAT
CCCGCTCCGGGCGctt
Downstream region at tRNA end position
tctccgttcc
Secondary structure (Cloverleaf model)
>At0817	Asp	GTC
                   a      Gctt tctccgttcc
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C
                     G - C
                     A - T          T A
                    T     C G C C C     A
      T G A        G      | | | | |     A
    G       T G T G       G C G G G     C
    G         | | +                 T T
    C       T C A T
      C C A        A     TGAC
                    C - G
                    A - T
                    A - T
                    C - G
                    C - G
                  C       C
                  T       A
                    G T C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCCGGATGGTGTAGTGGCCCATCATACAACCCTGTCACGGTTGTGACGCGGGTTCAAAT
CCCGCTCCGGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK