The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0837
Genome IDAE004437
Search identical group
Phylum/ClassEuryarchaeota
SpeciesHalobacterium salinarum NRC-1; ATCC 700922 [AE004437]
Start position on genome 1838642
End posion on genome 1838568
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
tgccggatgc
tRNA gene sequence
GGGCGCGTAGCTCAGTCCGGACAGAGCGTTCGGCTTCTAACCGAAATGTCGGGGGTTCGA
ATCCCCTCGTGCCCGtgg
Downstream region at tRNA end position
cgtcggctgg
Secondary structure (Cloverleaf model)
>At0837	Arg	TCT
                   c      Gtgg cgtcggctgg
                     G - C
                     G - C
                     G - C
                     C - G
                     G + T
                     C - G
                     G - C          T A
                    T     T C C C C     A
    C T G A        A      + | | | |     G
  C         C T C G       G G G G G     C
  G         | | | |                 T T
  G         G A G C
    A C A          G     ATGTC
                    T - A
                    T - A
                    C - G
                    G - C
                    G - C
                  C       A
                  T       A
                    T C T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCGCGTAGCTCAGTCCGGACAGAGCGTTCGGCTTCTAACCGAAATGTCGGGGGTTCGA
ATCCCCTCGTGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK