The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0838
Genome IDAE004437
Search identical group
Phylum/ClassEuryarchaeota
SpeciesHalobacterium salinarum NRC-1; ATCC 700922 [AE004437]
Start position on genome 1882136
End posion on genome 1882063
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
gtgtactcgt
tRNA gene sequence
GGGCCGATAGCTCAGCCCGGCAGAGCGTCTGGCTTTTAACCAGACGGTCGAGGGTTCAAA
TCCCTCTCGGCCCGttc
Downstream region at tRNA end position
gaccgctgtt
Secondary structure (Cloverleaf model)
>At0838	Lys	TTT
                   t      Gttc gaccgctgtt
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C
                     A - T          T A
                    T     C T C C C     A
      C G A        A      | | | | |     A
    C       C T C G       G A G G G     C
    C       | | | |                 T T
    G       G A G C
      G C A        G     CGGTC
                    T - A
                    C - G
                    T - A
                    G - C
                    G - C
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCGATAGCTCAGCCCGGCAGAGCGTCTGGCTTTTAACCAGACGGTCGAGGGTTCAAA
TCCCTCTCGGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK