The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0839
Genome IDAE004437
Search identical group
Phylum/ClassEuryarchaeota
SpeciesHalobacterium salinarum NRC-1; ATCC 700922 [AE004437]
Start position on genome 1984312
End posion on genome 1984241
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
gcgcggtcgc
tRNA gene sequence
GGGCTCGTAGATCAGCGGTAGATCGCTTCCTTCGCAAGGAAGAGGCCCTGGGTTCAAATC
CCAGCGAGTCCActc
Downstream region at tRNA end position
ctgtatttgc
Secondary structure (Cloverleaf model)
>At0839	Ala	CGC
                   c      Actc ctgtatttgc
                     G - C
                     G - C
                     G + T
                     C - G
                     T - A
                     C - G
                     G - C          T A
                    T     G A C C C     A
        G A        A      | | | | |     A
      C     C T A G       C T G G G     C
      G     | | | |                 T T
      G     G A T C
        T A        G     AGGCC
                    C - G
                    T - A
                    T - A
                    C - G
                    C - G
                  T       A
                  T       A
                    C G C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCTCGTAGATCAGCGGTAGATCGCTTCCTTCGCAAGGAAGAGGCCCTGGGTTCAAATC
CCAGCGAGTCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK