The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0845
Genome IDAM180088
Search identical group
Phylum/ClassEuryarchaeota
SpeciesHaloquadratum walsbyi DSM 16790 DSM 16790 [AM180088]
Start position on genome 201346
End posion on genome 201418
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
tgaattaata
tRNA gene sequence
GGGCTCGTGGTCTAGTGGTTATGACGCTTCCCTTACAAGGAAGAGGTCGGTGGTTCAAAT
CCGCCCGAGCCCActc
Downstream region at tRNA end position
ctattggatg
Secondary structure (Cloverleaf model)
>At0845	Val	TAC
                   a      Actc ctattggatg
                     G - C
                     G - C
                     G - C
                     C - G
                     T - A
                     C - G
                     G - C          T A
                    T     C C G C C     A
      T G A        G      | | + | |     A
    G       T C T G       G G T G G     C
    G         | | |                 T T
    T       T G A C
      T A          G     AGGTC
                    C - G
                    T - A
                    T - A
                    C - G
                    C - G
                  C       A
                  T       A
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCTCGTGGTCTAGTGGTTATGACGCTTCCCTTACAAGGAAGAGGTCGGTGGTTCAAAT
CCGCCCGAGCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK