The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0848
Genome IDAM180088
Search identical group
Phylum/ClassEuryarchaeota
SpeciesHaloquadratum walsbyi DSM 16790 DSM 16790 [AM180088]
Start position on genome 864220
End posion on genome 864292
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
ttccaactgt
tRNA gene sequence
AGTCCCGTGGTGTAGTGGCCAATCATAACGGCCTTTGGAGCCGTTGACGGCGGTTCGAAT
CCGCCCGGGACTAtct
Downstream region at tRNA end position
cctattgatg
Secondary structure (Cloverleaf model)
>At0848	Gln	TTG
                   t      Atct cctattgatg
                     A - T
                     G - C
                     T - A
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     C C G C C     A
      T G A        G      | | | | |     G
    G       T G T G       G G C G G     C
    G         | | +                 T T
    C       T C A T
      C A A        A     TGAC
                    A - T
                    C - G
                    G - C
                    G - C
                    C - G
                  C       A
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGTCCCGTGGTGTAGTGGCCAATCATAACGGCCTTTGGAGCCGTTGACGGCGGTTCGAAT
CCGCCCGGGACTA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK