The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0866
Genome IDAM180088
Search identical group
Phylum/ClassEuryarchaeota
SpeciesHaloquadratum walsbyi DSM 16790 DSM 16790 [AM180088]
Start position on genome 386951
End posion on genome 386867
Amino Acid Ser
Anticodon CGA
Upstream region at tRNA start position
tatatatcaa
tRNA gene sequence
GCCGAGGTAGCCTAGCCTGGTCAAGGCGGCAGATTCGAAATCTGCTGTCCGCTCGGACAC
GTGAGTTCAAATCTCACCCTCGGCGttg
Downstream region at tRNA end position
caaatattct
Secondary structure (Cloverleaf model)
>At0866	Ser	CGA
                   a      Gttg caaatattct
                     G - C
                     C - G
                     C - G
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C A C T C     A
    C C G A        A      | | | | |     A
  T         T C C G       G T G A G     C
  G         | | | |                 T T
  G         A G G C
    T C A          G     TGTCCGCTCGGACAC
                    G - C
                    C - G
                    A - T
                    G - C
                    A - T
                  T       A
                  T       A
                    C G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCGAGGTAGCCTAGCCTGGTCAAGGCGGCAGATTCGAAATCTGCTGTCCGCTCGGACAC
GTGAGTTCAAATCTCACCCTCGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK