The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0885
Genome IDCP000678
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanobrevibacter smithii ATCC 35061 ATCC 35061; PS; DSMZ 861 [CP000678]
Start position on genome 412228
End posion on genome 412299
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
aacaaaatat
tRNA gene sequence
AGTCCCGTAGGGTAGTGGTAATCCTTCTAGGCTTTGGACCCGGAGACGGCGGTTCGACTC
CGCTCGGGACTAttt
Downstream region at tRNA end position
ttaaaaaaaa
Secondary structure (Cloverleaf model)
>At0885	Gln	TTG
                   t      Attt ttaaaaaaaa
                     A - T
                     G - C
                     T - A
                     C - G
                     C - G
                     C - G
                     G - C          T C
                    T     T C G C C     A
      T G A        A      + | | | |     G
    G       T G G G       G G C G G     C
    G         | | +                 T T
    T       T C C T
      A A          T     AGAC
                    C - G
                    T + G
                    A   C
                    G - C
                    G - C
                  C       A
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGTCCCGTAGGGTAGTGGTAATCCTTCTAGGCTTTGGACCCGGAGACGGCGGTTCGACTC
CGCTCGGGACTA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK