The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0888
Genome IDCP000678
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanobrevibacter smithii ATCC 35061 ATCC 35061; PS; DSMZ 861 [CP000678]
Start position on genome 1105878
End posion on genome 1105951
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
ttgtatataa
tRNA gene sequence
GGGCCCGTAGCCTAGCTGGATAGGGCGTCGGACTTCTAATCCGAAGACCCCGGGTTCAAA
TCCCGGCGGGTCCGtat
Downstream region at tRNA end position
ttcttataaa
Secondary structure (Cloverleaf model)
>At0888	Arg	TCT
                   a      Gtat ttcttataaa
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G G C C C     A
      C G A        A      | | | | |     A
    T       T C C G       C C G G G     C
    G       + | | |                 T T
    G       G G G C
      A T A        G     AGACC
                    T - A
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    T C T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCCTAGCTGGATAGGGCGTCGGACTTCTAATCCGAAGACCCCGGGTTCAAA
TCCCGGCGGGTCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK