The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0891
Genome IDCP000678
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanobrevibacter smithii ATCC 35061 ATCC 35061; PS; DSMZ 861 [CP000678]
Start position on genome 1454656
End posion on genome 1454740
Amino Acid Ser
Anticodon GGA
Upstream region at tRNA start position
aagcaataat
tRNA gene sequence
GCCGAGATAGTCTAGCCTGGTAAGGCGCGAGACTGGAAATCTCGTGGGAGCTTTTCCCTC
CTGGGTTCAAATCCCAGTCTCGGCGttt
Downstream region at tRNA end position
attagttttt
Secondary structure (Cloverleaf model)
>At0891	Ser	GGA
                   t      Gttt attagttttt
                     G - C
                     C - G
                     C - G
                     G - C
                     A - T
                     G - C
                     A - T          T A
                    T     G A C C C     A
      C G A        A      | | | | |     A
    C       T C T G       C T G G G     C
    T       | | + |                 T T
    G       A G G C
      G T A        G     TGGGAGCTTTTCCCTC
                    C - G
                    G - C
                    A - T
                    G - C
                    A - T
                  C       A
                  T       A
                    G G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCGAGATAGTCTAGCCTGGTAAGGCGCGAGACTGGAAATCTCGTGGGAGCTTTTCCCTC
CTGGGTTCAAATCCCAGTCTCGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK