The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0906
Genome IDCP000678
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanobrevibacter smithii ATCC 35061 ATCC 35061; PS; DSMZ 861 [CP000678]
Start position on genome 878292
End posion on genome 878219
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
ttgtatgtga
tRNA gene sequence
GGGCCCGTAGCTCAGTCTGGCAGAGCGCTTGGCTTTTAACCAAGCGGCCGCGGGTTCAAT
TCCCGTCGGGCCCGttt
Downstream region at tRNA end position
tctaatttta
Secondary structure (Cloverleaf model)
>At0906	Lys	TTT
                   a      Gttt tctaatttta
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T T
                    T     T G C C C     A
      T G A        A      + | | | |     A
    C       C T C G       G C G G G     C
    T       | | | |                 T T
    G       G A G C
      G C A        G     CGGCC
                    C - G
                    T - A
                    T - A
                    G - C
                    G - C
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCTCAGTCTGGCAGAGCGCTTGGCTTTTAACCAAGCGGCCGCGGGTTCAAT
TCCCGTCGGGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK