The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0926
Genome IDL77117
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanocaldococcus jannaschii DSM 2661 [L77117]
Start position on genome 358768
End posion on genome 358845
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
gagataaaga
tRNA gene sequence
GGACCCGTAGCCTAGCCTGGATAGGGCACCGGCCTTCTAAGCCGGGGGTCGGGGGTTCAA
ATCCCCTCGGGTCCGCCA
Downstream region at tRNA end position
atttttctat
Secondary structure (Cloverleaf model)
>At0926	Arg	TCT
                   a      GCCA atttttctat
                     G - C
                     G - C
                     A - T
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     T C C C C     A
    C C G A        A      + | | | |     A
  T         T C C G       G G G G G     C
  G         + | | |                 T T
  G         G G G C
    A T A          A     GGGTC
                    C - G
                    C - G
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A
                    T C T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGACCCGTAGCCTAGCCTGGATAGGGCACCGGCCTTCTAAGCCGGGGGTCGGGGGTTCAA
ATCCCCTCGGGTCCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK