The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0935
Genome IDL77117
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanocaldococcus jannaschii DSM 2661 [L77117]
Start position on genome 764021
End posion on genome 764096
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
cgtttgatgt
tRNA gene sequence
AGCCCGGTGGTGTAGTGGCCTATCATCCGGGGCTTTGGACCCCGGGACCGCGGTTCGAAT
CCGCGCCGGGCTACCA
Downstream region at tRNA end position
tttttatttt
Secondary structure (Cloverleaf model)
>At0935	Gln	TTG
                   t      ACCA tttttatttt
                     A - T
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     G C G C C     A
      T G A        G      | | | | |     G
    G       T G T G       C G C G G     C
    G         | | +                 T T
    C       T C A T
      C T A        C     GGAC
                    C - G
                    G - C
                    G - C
                    G - C
                    G - C
                  C       A
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGCCCGGTGGTGTAGTGGCCTATCATCCGGGGCTTTGGACCCCGGGACCGCGGTTCGAAT
CCGCGCCGGGCTACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK