The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0941
Genome IDL77117
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanocaldococcus jannaschii DSM 2661 [L77117]
Start position on genome 864064
End posion on genome 864141
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
gcattactat
tRNA gene sequence
GCCCTGGTGGTGTAGCCCGGCCTATCATACGGGACTGTCACTCCCGTGACTCGGGTTCAA
ATCCCGGCCAGGGCGCCA
Downstream region at tRNA end position
tttgccgggc
Secondary structure (Cloverleaf model)
>At0941	Asp	GTC
                   t      GCCA tttgccgggc
                     G - C
                     C - G
                     C - G
                     C - G
                     T - A
                     G - C
                     G - C          T A
                    T     G G C C C     A
    C C G A        G      + | | | |     A
  C         T G T G       T C G G G     C
  G           | | +                 T T
  G         T C A T
    C C T A        A     TGAC
                    C - G
                    G - C
                    G - C
                    G - C
                    A - T
                  C       C
                  T       A
                    G T C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCCTGGTGGTGTAGCCCGGCCTATCATACGGGACTGTCACTCCCGTGACTCGGGTTCAA
ATCCCGGCCAGGGCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK