The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0942
Genome IDL77117
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanocaldococcus jannaschii DSM 2661 [L77117]
Start position on genome 883681
End posion on genome 883754
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
taaaggttga
tRNA gene sequence
GGGCCCATGGTCTAGCTGGCTATGACGTCGCCCTTACAAGGCGAAGGTCGCCGGTTCGAA
TCCGGCTGGGCCCActa
Downstream region at tRNA end position
tttttatttt
Secondary structure (Cloverleaf model)
>At0942	Val	TAC
                   a      Acta tttttatttt
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     A - T          T A
                    T     C G G C C     A
      C G A        G      | | | | |     G
    T       T C T G       G C C G G     C
    G         | | |                 T T
    G       T G A C
      C T A        G     AGGTC
                    T - A
                    C - G
                    G - C
                    C - G
                    C - G
                  C       A
                  T       A
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCATGGTCTAGCTGGCTATGACGTCGCCCTTACAAGGCGAAGGTCGCCGGTTCGAA
TCCGGCTGGGCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK