The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0966
Genome IDCP000300
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcoides burtonii DSM 6242 [CP000300]
Start position on genome 1404391
End posion on genome 1404462
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
tttatccata
tRNA gene sequence
GGGCTCGTAGATCAGGGGTAGATCGTTACGTTCGCAACGTAAAGGCCGCGGGTTCAAATC
CCGCCGAGTCCAtta
Downstream region at tRNA end position
gagagatcat
Secondary structure (Cloverleaf model)
>At0966	Ala	CGC
                   a      Atta gagagatcat
                     G - C
                     G - C
                     G + T
                     C - G
                     T - A
                     C - G
                     G - C          T A
                    T     C G C C C     A
        G A        A      | | | | |     A
      G     C T A G       G C G G G     C
      G     | | | |                 T T
      G     G A T C
        T A        G     AGGCC
                    T - A
                    T - A
                    A - T
                    C - G
                    G - C
                  T       A
                  T       A
                    C G C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCTCGTAGATCAGGGGTAGATCGTTACGTTCGCAACGTAAAGGCCGCGGGTTCAAATC
CCGCCGAGTCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK