The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0975
Genome IDCP000300
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcoides burtonii DSM 6242
Start position on genome 2257451
End posion on genome 2257524
Amino Acid Lys
Anticodon CTT
Upstream region at tRNA start position
atcattgcgt
tRNA gene sequence
GGGCCGGTAGCTTAGTCAGGCAGAGCGATGGACTCTTAATCCATCGGCCGAGGGTTCAAA
TCCCTTCCGGCCCGctt
Downstream region at tRNA end position
aatttatgtg
Secondary structure (Cloverleaf model)
>At0975	Lys	CTT
                   t      Gctt aatttatgtg
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     T T C C C     A
      T G A        A      + | | | |     A
    C       T T C G       G A G G G     C
    A       + | | |                 T T
    G       G A G C
      G C A        G     CGGCC
                    A - T
                    T - A
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    C T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCGGTAGCTTAGTCAGGCAGAGCGATGGACTCTTAATCCATCGGCCGAGGGTTCAAA
TCCCTTCCGGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK