The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0990
Genome IDCP000300
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcoides burtonii DSM 6242 [CP000300]
Start position on genome 558140
End posion on genome 558064
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
ttgcacaaat
tRNA gene sequence
GGGCCCGTGGTCTAGTTGGTTATGACATCGCCTTTACACGGCGAGGATCATGAGTTCGAA
TCTCATCGGGCCCACCA
Downstream region at tRNA end position
cacttcattt
Secondary structure (Cloverleaf model)
>At0990	Val	TAC
                   t      ACCA cacttcattt
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     T A C T C     A
      T G A        G      | | | | |     G
    T       T C T G       A T G A G     C
    G         | | |                 T T
    G       T G A C
      T T A        A     GGATC
                    T - A
                    C - G
                    G - C
                    C - G
                    C - G
                  T       C
                  T       A
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTGGTCTAGTTGGTTATGACATCGCCTTTACACGGCGAGGATCATGAGTTCGAA
TCTCATCGGGCCCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK