The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0997
Genome IDCP000300
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcoides burtonii DSM 6242 [CP000300]
Start position on genome 1271469
End posion on genome 1271393
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
tgatcgccgt
tRNA gene sequence
GGGCTTGTAGCTTAGTCAGGCAGAGCGTCTGGCTTTTAACCAGACGGTCTAGGGTTCAAA
TCCCTACAAGCCCGCCA
Downstream region at tRNA end position
gcaatctgga
Secondary structure (Cloverleaf model)
>At0997	Lys	TTT
                   t      GCCA gcaatctgga
                     G - C
                     G - C
                     G - C
                     C - G
                     T - A
                     T - A
                     G - C          T A
                    T     A T C C C     A
      T G A        A      | | | | |     A
    C       T T C G       T A G G G     C
    A       + | | |                 T T
    G       G A G C
      G C A        G     CGGTC
                    T - A
                    C - G
                    T - A
                    G - C
                    G - C
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCTTGTAGCTTAGTCAGGCAGAGCGTCTGGCTTTTAACCAGACGGTCTAGGGTTCAAA
TCCCTACAAGCCCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK