The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1002
Genome IDCP000300
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcoides burtonii DSM 6242 [CP000300]
Start position on genome 1617491
End posion on genome 1617419
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
caaggtgtga
tRNA gene sequence
AGTCCCGTTGAGTAGCGGTCAATCTTTCAAGCCTTTGGAGCTTGAGACCCCGGTTCGAAT
CCGGGCGGGACTAtta
Downstream region at tRNA end position
catttatttt
Secondary structure (Cloverleaf model)
>At1002	Gln	TTG
                   a      Atta catttatttt
                     A - T
                     G - C
                     T - A
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G G G C C     A
      C G A        T      | | | | |     G
    G       T G A G       C C C G G     C
    G         | | +                 T T
    T       T C T T
      C A A        T     AGAC
                    C - G
                    A - T
                    A - T
                    G - C
                    C - G
                  C       A
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGTCCCGTTGAGTAGCGGTCAATCTTTCAAGCCTTTGGAGCTTGAGACCCCGGTTCGAAT
CCGGGCGGGACTA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK