The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1014
Genome IDCP000743
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcus aeolicus Nankai-3 [CP000743]
Start position on genome 978297
End posion on genome 978370
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
aaattgcatt
tRNA gene sequence
GGACCCATGGTCTAGTTGGCTATGACATCGCCCTTACAAGGCGAGGGTCGCCGGTTCGAA
TCCGGCTGGGTCCAtta
Downstream region at tRNA end position
tttttatatg
Secondary structure (Cloverleaf model)
>At1014	Val	TAC
                   t      Atta tttttatatg
                     G - C
                     G - C
                     A - T
                     C - G
                     C - G
                     C - G
                     A - T          T A
                    T     C G G C C     A
      T G A        G      | | | | |     G
    T       T C T G       G C C G G     C
    G         | | |                 T T
    G       T G A C
      C T A        A     GGGTC
                    T - A
                    C - G
                    G - C
                    C - G
                    C - G
                  C       A
                  T       A
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGACCCATGGTCTAGTTGGCTATGACATCGCCCTTACAAGGCGAGGGTCGCCGGTTCGAA
TCCGGCTGGGTCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK