The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1015
Genome IDCP000743
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcus aeolicus Nankai-3 [CP000743]
Start position on genome 1029211
End posion on genome 1029285
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
acattgaagt
tRNA gene sequence
GGGCCCGTGGCCTAGTCTGGATACGGCACCGGCCTTCTAAGCCGGGGATCGGGGGTTCAA
ATCCCTCTGGGTCCGttc
Downstream region at tRNA end position
aattaattta
Secondary structure (Cloverleaf model)
>At1015	Arg	TCT
                   t      Gttc aattaattta
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     C - G
                     G + T          T A
                    T     C T C C C     A
    C T G A        G      | + | | |     A
  T         T C C G       G G G G G     C
  G           | | |                 T T
  G         C G G C
    A T A          A     GGATC
                    C - G
                    C - G
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A
                    T C T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTGGCCTAGTCTGGATACGGCACCGGCCTTCTAAGCCGGGGATCGGGGGTTCAA
ATCCCTCTGGGTCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK