The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1037
Genome IDCP000743
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcus aeolicus Nankai-3 [CP000743]
Start position on genome 1377817
End posion on genome 1377744
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
tgcaaacatt
tRNA gene sequence
GGGCCCGTAGCTTAGTCTGGTAGAGCGCCTGACTTTTAATCAGGCGGTCGAGGGTTCGAA
TCCCTTCGGGCCCGtta
Downstream region at tRNA end position
caatacttta
Secondary structure (Cloverleaf model)
>At1037	Lys	TTT
                   t      Gtta caatacttta
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     T T C C C     A
      T G A        A      + | | | |     G
    C       T T C G       G A G G G     C
    T       + | | |                 T T
    G       G A G C
      G T A        G     CGGTC
                    C - G
                    C - G
                    T - A
                    G - C
                    A - T
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCTTAGTCTGGTAGAGCGCCTGACTTTTAATCAGGCGGTCGAGGGTTCGAA
TCCCTTCGGGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK