The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1074
Genome IDCP000609
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcus maripaludis C5 [CP000609]
Start position on genome 1517269
End posion on genome 1517196
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
tacgcaacat
tRNA gene sequence
GGGCCCGTAGCTTAGTCTGGTAGAGCGCCTGACTTTTAATCAGGCGGTCGAGGGTTCGAA
TCCCTTCGGGCCCGctc
Downstream region at tRNA end position
aaaattattt
Secondary structure (Cloverleaf model)
>At1074	Lys	TTT
                   t      Gctc aaaattattt
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     T T C C C     A
      T G A        A      + | | | |     G
    C       T T C G       G A G G G     C
    T       + | | |                 T T
    G       G A G C
      G T A        G     CGGTC
                    C - G
                    C - G
                    T - A
                    G - C
                    A - T
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCTTAGTCTGGTAGAGCGCCTGACTTTTAATCAGGCGGTCGAGGGTTCGAA
TCCCTTCGGGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK