The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1075
Genome IDCP000609
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcus maripaludis C5 [CP000609]
Start position on genome 1517372
End posion on genome 1517298
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
catttcacat
tRNA gene sequence
GCTCTGGTGGTGTAGCTCGGCCTATCATACAGGACTGTCACTCCTGTGACTCGGGTTCAA
ATCCCGGCCAGAGCGcct
Downstream region at tRNA end position
tttctatttt
Secondary structure (Cloverleaf model)
>At1075	Asp	GTC
                   t      Gcct tttctatttt
                     G - C
                     C - G
                     T - A
                     C - G
                     T - A
                     G - C
                     G - C          T A
                    T     G G C C C     A
    T C G A        G      + | | | |     A
  C         T G T G       T C G G G     C
  G           | | +                 T T
  G         T C A T
    C C T A        A     TGAC
                    C - G
                    A - T
                    G - C
                    G - C
                    A - T
                  C       C
                  T       A
                    G T C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCTCTGGTGGTGTAGCTCGGCCTATCATACAGGACTGTCACTCCTGTGACTCGGGTTCAA
ATCCCGGCCAGAGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK