The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1088
Genome IDCP000745
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcus maripaludis [CP000745]
Start position on genome 1040102
End posion on genome 1040177
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
ctgttaaaga
tRNA gene sequence
AGCCCAGTAGTGTAGTGGCCAATCATCTGTGCCTTTGGAGCATGGGACCGCGGTTCGAAT
CCGCGCTGGGCTACCA
Downstream region at tRNA end position
tttttcattt
Secondary structure (Cloverleaf model)
>At1088	Gln	TTG
                   a      ACCA tttttcattt
                     A - T
                     G - C
                     C - G
                     C - G
                     C - G
                     A - T
                     G - C          T A
                    T     G C G C C     A
      T G A        A      | | | | |     G
    G       T G T G       C G C G G     C
    G         | | +                 T T
    C       T C A T
      C A A        C     GGAC
                    T + G
                    G + T
                    T - A
                    G - C
                    C - G
                  C       A
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGCCCAGTAGTGTAGTGGCCAATCATCTGTGCCTTTGGAGCATGGGACCGCGGTTCGAAT
CCGCGCTGGGCTACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK