The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1092
Genome IDCP000745
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcus maripaludis [CP000745]
Start position on genome 1072206
End posion on genome 1072279
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
tattctttcg
tRNA gene sequence
GGGCCCGTAGCTTAGTCTGGTAGAGCGCCTGACTTTTAATCAGGCGGTCGAGGGTTCGAA
TCCCTTCGGGCCCGctc
Downstream region at tRNA end position
aaaaaacacg
Secondary structure (Cloverleaf model)
>At1092	Lys	TTT
                   g      Gctc aaaaaacacg
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     T T C C C     A
      T G A        A      + | | | |     G
    C       T T C G       G A G G G     C
    T       + | | |                 T T
    G       G A G C
      G T A        G     CGGTC
                    C - G
                    C - G
                    T - A
                    G - C
                    A - T
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCTTAGTCTGGTAGAGCGCCTGACTTTTAATCAGGCGGTCGAGGGTTCGAA
TCCCTTCGGGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK