The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1095
Genome IDCP000745
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcus maripaludis [CP000745]
Start position on genome 1072657
End posion on genome 1072731
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
tatttcacat
tRNA gene sequence
GCCCTGGTGGTGTAGCTCGGCCTATCATACAGGACTGTCACTCCTGTGACTCGGGTTCAA
ATCCCGGCCAGGGCGctt
Downstream region at tRNA end position
ttttgataat
Secondary structure (Cloverleaf model)
>At1095	Asp	GTC
                   t      Gctt ttttgataat
                     G - C
                     C - G
                     C - G
                     C - G
                     T - A
                     G - C
                     G - C          T A
                    T     G G C C C     A
    T C G A        G      + | | | |     A
  C         T G T G       T C G G G     C
  G           | | +                 T T
  G         T C A T
    C C T A        A     TGAC
                    C - G
                    A - T
                    G - C
                    G - C
                    A - T
                  C       C
                  T       A
                    G T C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCCTGGTGGTGTAGCTCGGCCTATCATACAGGACTGTCACTCCTGTGACTCGGGTTCAA
ATCCCGGCCAGGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK