The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1128
Genome IDBX950229
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcus maripaludis S2 [BX950229]
Start position on genome 335487
End posion on genome 335564
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
atggagacgg
tRNA gene sequence
GGGCCCGTGGCCTAGTCTGGATACGGCACCGGCCTTCTAAGCCGGGGATCGGGGGTTCGA
ATCCCTCCGGGTCCGCCA
Downstream region at tRNA end position
ttactacttt
Secondary structure (Cloverleaf model)
>At1128	Arg	TCT
                   g      GCCA ttactacttt
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     C T C C C     A
    C T G A        G      | + | | |     G
  T         T C C G       G G G G G     C
  G           | | |                 T T
  G         C G G C
    A T A          A     GGATC
                    C - G
                    C - G
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A
                    T C T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTGGCCTAGTCTGGATACGGCACCGGCCTTCTAAGCCGGGGATCGGGGGTTCGA
ATCCCTCCGGGTCCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK