The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1134
Genome IDBX950229
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcus maripaludis S2 [BX950229]
Start position on genome 1305759
End posion on genome 1305846
Amino Acid Ser
Anticodon GGA
Upstream region at tRNA start position
agtactgtgt
tRNA gene sequence
GCAGAGATAGTCTAGCCTGGGAAGGCGTACGGCTGGAAACCGTATGAGGCTTTGCCTCCC
GGGGGTTCAAATCCCCCTCTCTGCGCCA
Downstream region at tRNA end position
tttatttttt
Secondary structure (Cloverleaf model)
>At1134	Ser	GGA
                   t      GCCA tttatttttt
                     G - C
                     C - G
                     A - T
                     G - C
                     A - T
                     G - C
                     A - T          T A
                    T     C C C C C     A
      C G A        A      | | | | |     A
    C       T C T G       G G G G G     C
    T       | | + |                 T T
    G       A G G C
      G G A        G     TGAGGCTTTGCCTCCC
                    T - A
                    A - T
                    C - G
                    G - C
                    G - C
                  C       A
                  T       A
                    G G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCAGAGATAGTCTAGCCTGGGAAGGCGTACGGCTGGAAACCGTATGAGGCTTTGCCTCCC
GGGGGTTCAAATCCCCCTCTCTGCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK