The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1148
Genome IDBX950229
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcus maripaludis S2 [BX950229]
Start position on genome 1431129
End posion on genome 1431053
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
gaagcaaaaa
tRNA gene sequence
GGACCTATGGTCTAGTTGGCTATGACATCGCCCTTACAAGGCGAGGGTCGCCGGTTCGAA
TCCGGCTAGGTCCACCA
Downstream region at tRNA end position
tttttatttt
Secondary structure (Cloverleaf model)
>At1148	Val	TAC
                   a      ACCA tttttatttt
                     G - C
                     G - C
                     A - T
                     C - G
                     C - G
                     T - A
                     A - T          T A
                    T     C G G C C     A
      T G A        G      | | | | |     G
    T       T C T G       G C C G G     C
    G         | | |                 T T
    G       T G A C
      C T A        A     GGGTC
                    T - A
                    C - G
                    G - C
                    C - G
                    C - G
                  C       A
                  T       A
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGACCTATGGTCTAGTTGGCTATGACATCGCCCTTACAAGGCGAGGGTCGCCGGTTCGAA
TCCGGCTAGGTCCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK