The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1166
Genome IDCP000742
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcus vannielii SB [CP000742]
Start position on genome 1127238
End posion on genome 1127311
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
atcccctcat
tRNA gene sequence
GGGCCCGTAGCTTAGTCTGGTAGAGCGCCTGACTTTTAATCAGGCGGTCGAGGGTTCGAA
TCCCTTCGGGCCCGttc
Downstream region at tRNA end position
aaaacattaa
Secondary structure (Cloverleaf model)
>At1166	Lys	TTT
                   t      Gttc aaaacattaa
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     T T C C C     A
      T G A        A      + | | | |     G
    C       T T C G       G A G G G     C
    T       + | | |                 T T
    G       G A G C
      G T A        G     CGGTC
                    C - G
                    C - G
                    T - A
                    G - C
                    A - T
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCTTAGTCTGGTAGAGCGCCTGACTTTTAATCAGGCGGTCGAGGGTTCGAA
TCCCTTCGGGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK