The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1167
Genome IDCP000742
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcus vannielii SB [CP000742]
Start position on genome 1127478
End posion on genome 1127552
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
tattccaaat
tRNA gene sequence
GCCCTGGTGGTGTAGCTCGGCCTATCATACAGGACTGTCACTCCTGTGACTCGGGTTCAA
ATCCCGGCCAGGGCGctt
Downstream region at tRNA end position
tgcgtctttt
Secondary structure (Cloverleaf model)
>At1167	Asp	GTC
                   t      Gctt tgcgtctttt
                     G - C
                     C - G
                     C - G
                     C - G
                     T - A
                     G - C
                     G - C          T A
                    T     G G C C C     A
    T C G A        G      + | | | |     A
  C         T G T G       T C G G G     C
  G           | | +                 T T
  G         T C A T
    C C T A        A     TGAC
                    C - G
                    A - T
                    G - C
                    G - C
                    A - T
                  C       C
                  T       A
                    G T C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCCTGGTGGTGTAGCTCGGCCTATCATACAGGACTGTCACTCCTGTGACTCGGGTTCAA
ATCCCGGCCAGGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK