The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1172
Genome IDCP000742
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcus vannielii SB [CP000742]
Start position on genome 1376175
End posion on genome 1376249
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
gtagagacgg
tRNA gene sequence
GGGCCCGTGGCCTAGTCTGGATACGGCACCGGCCTTCTAAGCCGGGGATCGGGGGTTCAA
ATCCCTCCGGGTCCGttt
Downstream region at tRNA end position
taataaattt
Secondary structure (Cloverleaf model)
>At1172	Arg	TCT
                   g      Gttt taataaattt
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     C T C C C     A
    C T G A        G      | + | | |     A
  T         T C C G       G G G G G     C
  G           | | |                 T T
  G         C G G C
    A T A          A     GGATC
                    C - G
                    C - G
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A
                    T C T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTGGCCTAGTCTGGATACGGCACCGGCCTTCTAAGCCGGGGATCGGGGGTTCAA
ATCCCTCCGGGTCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK