The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1182
Genome IDCP000742
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcus vannielii SB [CP000742]
Start position on genome 811493
End posion on genome 811420
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
taagcaaata
tRNA gene sequence
GGACTCATGGTCTAGTTGGCTATGACATCGCCCTTACAAGGCGAGGGTCGCCGGTTCGAA
TCCGGCTGGGTCCActa
Downstream region at tRNA end position
ttttaatttt
Secondary structure (Cloverleaf model)
>At1182	Val	TAC
                   a      Acta ttttaatttt
                     G - C
                     G - C
                     A - T
                     C - G
                     T + G
                     C - G
                     A - T          T A
                    T     C G G C C     A
      T G A        G      | | | | |     G
    T       T C T G       G C C G G     C
    G         | | |                 T T
    G       T G A C
      C T A        A     GGGTC
                    T - A
                    C - G
                    G - C
                    C - G
                    C - G
                  C       A
                  T       A
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGACTCATGGTCTAGTTGGCTATGACATCGCCCTTACAAGGCGAGGGTCGCCGGTTCGAA
TCCGGCTGGGTCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK