The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1202
Genome IDCP000559
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanocorpusculum labreanum Z [CP000559]
Start position on genome 595408
End posion on genome 595480
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
taattcgcca
tRNA gene sequence
ACTCCTGTAGTGTAGTGGTCAATCATTCCGGCCTTTGGAGCCGGAGACGGTGGTTCGAGT
CCGCCCAGGAGTAtcg
Downstream region at tRNA end position
gcctgttttt
Secondary structure (Cloverleaf model)
>At1202	Gln	TTG
                   a      Atcg gcctgttttt
                     A - T
                     C - G
                     T - A
                     C - G
                     C - G
                     T - A
                     G - C          T G
                    T     C C G C C     A
      T G A        A      | | + | |     G
    G       T G T G       G G T G G     C
    G         | | +                 T T
    T       T C A T
      C A A        T     AGAC
                    C - G
                    C - G
                    G - C
                    G - C
                    C - G
                  C       A
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
ACTCCTGTAGTGTAGTGGTCAATCATTCCGGCCTTTGGAGCCGGAGACGGTGGTTCGAGT
CCGCCCAGGAGTA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK