The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1217
Genome IDCP000559
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanocorpusculum labreanum Z [CP000559]
Start position on genome 375982
End posion on genome 375909
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
aaggtaattt
tRNA gene sequence
GGACTCGTGGTCTAGGTGGTTATGACGCCAGCCTTACATGCTGGAGGTCAGGGGTTCGAA
TCCCTTCGGGTCCActc
Downstream region at tRNA end position
tttttgattt
Secondary structure (Cloverleaf model)
>At1217	Val	TAC
                   t      Actc tttttgattt
                     G - C
                     G - C
                     A - T
                     C - G
                     T + G
                     C - G
                     G - C          T A
                    T     T T C C C     A
      G G A        G      | + | | |     G
    T       T C T G       A G G G G     C
    G         | | |                 T T
    G       T G A C
      T T A        G     AGGTC
                    C - G
                    C - G
                    A - T
                    G - C
                    C - G
                  C       T
                  T       A
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGACTCGTGGTCTAGGTGGTTATGACGCCAGCCTTACATGCTGGAGGTCAGGGGTTCGAA
TCCCTTCGGGTCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK