The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1231
Genome IDCP000559
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanocorpusculum labreanum Z [CP000559]
Start position on genome 1186014
End posion on genome 1185941
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
tgaaacacaa
tRNA gene sequence
GGGCCAGTAGATCAGTCAGGCAGATCGTCGGACTTTTAATCCGCAGGTCGGGGGTTCAAC
TCCCTCCTGGCCCGctt
Downstream region at tRNA end position
cacgccttcg
Secondary structure (Cloverleaf model)
>At1231	Lys	TTT
                   a      Gctt cacgccttcg
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     A - T
                     G - C          T C
                    T     C T C C C     A
      T G A        A      | + | | |     A
    C       C T A G       G G G G G     C
    A       | | | |                 T T
    G       G A T C
      G C A        G     AGGTC
                    T   C
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCAGTAGATCAGTCAGGCAGATCGTCGGACTTTTAATCCGCAGGTCGGGGGTTCAAC
TCCCTCCTGGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK