The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1239
Genome IDCP000559
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanocorpusculum labreanum Z [CP000559]
Start position on genome 1432125
End posion on genome 1432051
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
ttaccagcgt
tRNA gene sequence
GGGCTTGTGGCTTAGCCAGGATATAGCGTCGGGCTTCTAACCCGAATGTCGGGGGTTCGA
ATCCCTCCAGGCCCGtat
Downstream region at tRNA end position
aacgtttttt
Secondary structure (Cloverleaf model)
>At1239	Arg	TCT
                   t      Gtat aacgtttttt
                     G - C
                     G - C
                     G - C
                     C - G
                     T + G
                     T - A
                     G - C          T A
                    T     C T C C C     A
    C C G A        G      | + | | |     G
  A         T T C G       G G G G G     C
  G           | | |                 T T
  G         T A G C
    A T A          G     ATGTC
                    T - A
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       A
                    T C T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCTTGTGGCTTAGCCAGGATATAGCGTCGGGCTTCTAACCCGAATGTCGGGGGTTCGA
ATCCCTCCAGGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK