The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1245
Genome IDCP000562
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanoculleus marisnigri JR1 [CP000562]
Start position on genome 273652
End posion on genome 273725
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
agtacgcgcg
tRNA gene sequence
GGGTCTATAGCTCAGTTAGGTAGAGCGCCTGGCTTTTAACCAGGTGGTCGGGGGTTCAAA
TCCCCTTGGGCCCGttg
Downstream region at tRNA end position
ccatgggcga
Secondary structure (Cloverleaf model)
>At1245	Lys	TTT
                   g      Gttg ccatgggcga
                     G - C
                     G - C
                     G - C
                     T + G
                     C - G
                     T + G
                     A - T          T A
                    T     T C C C C     A
      T G A        A      + | | | |     A
    T       C T C G       G G G G G     C
    A       | | | |                 T T
    G       G A G C
      G T A        G     TGGTC
                    C - G
                    C - G
                    T - A
                    G - C
                    G - C
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGTCTATAGCTCAGTTAGGTAGAGCGCCTGGCTTTTAACCAGGTGGTCGGGGGTTCAAA
TCCCCTTGGGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK