The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1250
Genome IDCP000562
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanoculleus marisnigri JR1 [CP000562]
Start position on genome 740745
End posion on genome 740817
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
gatttcttgt
tRNA gene sequence
ACCCCCGTAGTGTAGTGGTCAATCATGCAGGACTTTGGATCCGGCGACGGCGGTTCGAAT
CCGCCCGGGGGTActa
Downstream region at tRNA end position
cattcgcccg
Secondary structure (Cloverleaf model)
>At1250	Gln	TTG
                   t      Acta cattcgcccg
                     A - T
                     C - G
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     C C G C C     A
      T G A        A      | | | | |     G
    G       T G T G       G G C G G     C
    G         | | +                 T T
    T       T C A T
      C A A        G     CGAC
                    C - G
                    A   G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
ACCCCCGTAGTGTAGTGGTCAATCATGCAGGACTTTGGATCCGGCGACGGCGGTTCGAAT
CCGCCCGGGGGTA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK