The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1264
Genome IDCP000562
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanoculleus marisnigri JR1 [CP000562]
Start position on genome 2001006
End posion on genome 2001080
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
aataccacag
tRNA gene sequence
GGGTCTGTGGCTTAGCCAGGACATAGCGCCGGGCTTCTAACCCGGACGTCGGGGGTTCGA
ATCCCCCCAGGCCCGtcg
Downstream region at tRNA end position
ttttttgata
Secondary structure (Cloverleaf model)
>At1264	Arg	TCT
                   g      Gtcg ttttttgata
                     G - C
                     G - C
                     G - C
                     T + G
                     C - G
                     T - A
                     G - C          T A
                    T     C C C C C     A
    C C G A        G      | | | | |     G
  A         T T C G       G G G G G     C
  G           | | |                 T T
  G         T A G C
    A C A          G     ACGTC
                    C - G
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       A
                    T C T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGTCTGTGGCTTAGCCAGGACATAGCGCCGGGCTTCTAACCCGGACGTCGGGGGTTCGA
ATCCCCCCAGGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK