The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1271
Genome IDCP000562
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanoculleus marisnigri JR1 [CP000562]
Start position on genome 248553
End posion on genome 248469
Amino Acid Ser
Anticodon CGA
Upstream region at tRNA start position
ctgattctgt
tRNA gene sequence
GCCGAGGTAGTCTAGTCCGGGAAGGCGGTGGCCTCGAAAGCCACTGGTGTTCGGCACCTC
GGGAGTTCAAATCTCCCCCTCGGCGttt
Downstream region at tRNA end position
tcaggtacct
Secondary structure (Cloverleaf model)
>At1271	Ser	CGA
                   t      Gttt tcaggtacct
                     G - C
                     C - G
                     C - G
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C C C T C     A
      T G A        A      | | | | |     A
    C       T C T G       G G G A G     C
    C       | | + |                 T T
    G       A G G C
      G G A        G     TGGTGTTCGGCACCTC
                    G - C
                    T - A
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A
                    C G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCGAGGTAGTCTAGTCCGGGAAGGCGGTGGCCTCGAAAGCCACTGGTGTTCGGCACCTC
GGGAGTTCAAATCTCCCCCTCGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK