The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1278
Genome IDCP000562
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanoculleus marisnigri JR1 [CP000562]
Start position on genome 638194
End posion on genome 638121
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
ggcatccaca
tRNA gene sequence
GGGCTTGTGGTCTAGCCGGTCATGACGTCGCCCTTACACGGCGAAGATCCCCGGTTCGAA
TCCGGGCAGGCCCAttc
Downstream region at tRNA end position
cttttgtaga
Secondary structure (Cloverleaf model)
>At1278	Val	TAC
                   a      Attc cttttgtaga
                     G - C
                     G - C
                     G - C
                     C - G
                     T + G
                     T - A
                     G - C          T A
                    T     G G G C C     A
      C G A        G      | | | | |     G
    C       T C T G       C C C G G     C
    G         | | |                 T T
    G       T G A C
      T C A        G     AGATC
                    T - A
                    C - G
                    G - C
                    C - G
                    C - G
                  C       C
                  T       A
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCTTGTGGTCTAGCCGGTCATGACGTCGCCCTTACACGGCGAAGATCCCCGGTTCGAA
TCCGGGCAGGCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK