The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1286
Genome IDCP000562
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanoculleus marisnigri JR1 [CP000562]
Start position on genome 1674181
End posion on genome 1674109
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
aacattgagt
tRNA gene sequence
GCCCAGGTAGTGTAGTGGCCTATCATGACGGCCTGTCACGCCGTCGACACGGATTCGAAT
TCCGTCCTGGGCGtca
Downstream region at tRNA end position
ctttctttca
Secondary structure (Cloverleaf model)
>At1286	Asp	GTC
                   t      Gtca ctttctttca
                     G - C
                     C - G
                     C - G
                     C - G
                     A - T
                     G - C
                     G - C          T A
                    T     T G C C T     A
      T G A        A      | | | | |     G
    G       T G T G       A C G G A     C
    G         | | +                 T T
    C       T C A T
      C T A        G     CGAC
                    A - T
                    C - G
                    G - C
                    G - C
                    C - G
                  C       C
                  T       A
                    G T C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCCAGGTAGTGTAGTGGCCTATCATGACGGCCTGTCACGCCGTCGACACGGATTCGAAT
TCCGTCCTGGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK