The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1295
Genome IDAE009439
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanopyrus kandleri AV19 [AE009439]
Start position on genome 172302
End posion on genome 172377
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
tgatgggagc
tRNA gene sequence
AGGGCCGTGGGGTAGCGGTCTATCCTGCGGGGCTTTGGACCCCGCGACCCCGGTTCAAAT
CCGGGCGGCCCTACCA
Downstream region at tRNA end position
ctccgaatcg
Secondary structure (Cloverleaf model)
>At1295	Gln	TTG
                   c      ACCA ctccgaatcg
                     A - T
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C          T A
                    T     G G G C C     A
      C G A        G      | | | | |     A
    G       T G G G       C C C G G     C
    G         | | +                 T T
    T       T C C T
      C T A        G     CGAC
                    C - G
                    G - C
                    G - C
                    G - C
                    G - C
                  C       A
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGGGCCGTGGGGTAGCGGTCTATCCTGCGGGGCTTTGGACCCCGCGACCCCGGTTCAAAT
CCGGGCGGCCCTACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK